Detection of plasma DNA integrity in lung cancer patients

To test the hypothesis that increased DNA integrity, ie, a longer DNA stand is a tumor-associated marker in plasma DNA .

The fragments between 600 and 700bp were cloned to pMD-18T,and three recombinants of pUC44,pUC26 and pUC30 were obtained,the results of the sequences analysis showed homologies to deduced long strand CpG ODN DNA which contained 10,11 or 13 copies of CTAGATCGTCGTTTTGTCGTTTTGTCGTTGAGGGGGGAT were 97.

In our model,DNA chain is regarded as freely connecting segments with a bead tethered to the end of the chain.

Studies on the DNA strand breakage as biomarker of exposure to aldehyde pollutants;

Study in vitro on the activity of poly(ADP-ribose)polymerase(PARP)and DNA strand breakage induced by nickel;

DNA strand breakage of human hepatoma cells induced by γ-ray measured using the Comet Assay;

5) in Beijing on micronucleus formation of Balb/c 3T3 cell and DNA strand breaks, were inspected using cytochalasin B-blocked test and single cell electrophoresis method; and their effects on gap junction intercellular communication (GJIC) of Balb/c 3T3 cells were observed through scrape-loading/dye transfer (SL/DT) technique.

The results showed that the deoxyguanosine modification and DNA strand breaks upon the concentration of peroxynitrite.

Objective To investigate DNA strand breaks and micronuclei induced by sodium pentachlorophen (Na-PCP) in different phases and different dosages in vivo.